Skip to main content

Table 1 Primers used for QPCR

From: Diet high in fat and sucrose induces rapid onset of obesity-related metabolic syndrome partly through rapid response of genes involved in lipogenesis, insulin signalling and inflammation in mice

Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
AMPK AAGATCGGACACTACGTCCTG TGCCACTTTATGGCCTGTCAA
Akt2 ACGTGGTGAATACATCAAGACC ACCCAATGAAAGATCCATCACTC
CD36 ATGGGCTGTGATCGGAACTG AGCCAGGACTGCACCAATAAC
CD68 GGACCCACAACTGTCACTCAT AAGCCCCACTTTAGCTTTACC
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
HMGCR TGTTCACCGGCAACAACAAGA CCGCGTTATCGTCAGGATGA
IRS2 TCTACACCCGAGACGAACACT TGGGCCTTTGCCCGATTATG
LDLR TGACTCAGACGAACAAGGCTG ATCTAGGCAATCTCGGTCTCC
LPL TTGCCCTAAGGACCCCTGAA ACAGAGTCTGCTAATCCAGGAAT
LXRα CTCAATGCCTGATGTTTCTCCT TCCAACCCTATCCCTAAAGCAA
MAC1 ATGGACGCTGATGGCAATACC TCCCCATTCACGTCTCCCA
MMP3 ACATGGAGACTTTGTCCCTTTTG TTGGCTGAGTGGTAGAGTCCC
PPARγ GGAAGACCACTCGCATTCCTT GTAATCAGCAACCATTGGGTCA
SCD-1 TTCTTGCGATACACTCTGGTGC CGGGATTGAATGTTCTTGTCGT
SREBP1c GATGTGCGAACTGGACA CATAGGGGGCGTCAAACAG
SREBP2 TGGGCGATGAGCTGACTCT ACTGTAGCATCTCGTCGATGT
  1. AMPK : 5' adenosine monophosphate-activated protein kinase, Akt2 : protein kinase B beta, CD36 : CD36 antigen, CD68 : CD68 antigen, FAS : fatty acid synthase, HMGCR : 3-hydroxy-3-methylglutaryl-coenzyme A reductase, IRS2: insulin receptor substrate 2, LDLR : low-density lipoprotein receptor, LPL : lipoprotein lipase, LXRα : liver X receptor alpha, MAC1 : macrophage-1 antigen, MMP3 : matrix metalloprotease 3, PPARγ : peroxisome proliferator activated receptor gamma, SCD-1 : stearoyl CoA desaturase-1, SREBP : sterol regulatory element binding protein.