Skip to main content

Table 1 Sequences of primer pairs used for amplification of mRNA by real time PCR

From: Epigallocatechin-3-gallate ameliorates hepatic damages by relieve FGF21 resistance and promotion of FGF21–AMPK pathway in mice fed a high fat diet

Target Forward primer Reverse primer
FGFR2 GCCTCTCGAACAGTATTCTCCT ACAGGGTTCATAAGGCATGGG
FGFR3 TGGATCAGTGAGAATGTGGAGG CCTATGAAATTGGTGGCTCGAC
FGFR4 GCTCGGAGGTAGAGGTCTTGT CCACGCTGACTGGTAGGAA
SREBP1 ACTTCTGGAGACATCGCAAAC GGTAGACAACAGCCGCATC
ACC1 TGGTCGTGACTGCTCTGTGC GTAGCCGAGGGTTCAGTTCC
SCD1 ATGTGCCAGAGGAGCTGAGT TGATCCACTGTTGCTTCTGC
Actin CGTAAAGACCTCTATGCCAACA CGGACTCATCGTACTCCTGCT
FAS GCTGCGGAAACTTCAGGAAAT AGAGACGTGTCACTCCTGGACTT
AMPK TACTCAACCGGCGAG CG AGACGGCGGCTTTCCTTTT
PPARα AGGAAGCCGTTCTGTGACAT TTGAAGGAGCTTTGGGAAGA
LKB1 TTCAACCGAGTGGGTTATTTTGT TACTGGGCATCTGGGGTGTAG
Actin CGTAAAGACCTCTATGCCAACA CGGACTCATCGTACTCCTGCT