Skip to main content

Table 2 Primers sequences used for qRT-PCR

From: Circ-FBXW12 aggravates the development of diabetic nephropathy by binding to miR-31-5p to induce LIN28B

Primers Sequences (5′–3′) Tm PCR product Ct range
circ-FBXW12-forward ACACGTGGCATGATCACACA 60.25 125 0.8
circ-FBXW12-reverse ACTCCTGGACTGGGCTTGAC 58.4
FBXW12-forward CTGCCTGGGTTAAGAGATGTTT 58.31 115 1.2
FBXW12-reverse AGGTACGACTGTATGTCCCAC 58.9
miR-31-5p-forward ACACTCCAGCTGGGAGGCAAGATGCTGGC 62.43 69 1.7
miR-31-5p-reverse TGGTGTCGTGGAGTCG 55.46
LIN28B-forward TTGAGTCAATACGGGTAACAGGA 59.17 184 0.9
LIN28B-reverse TGACAGTAATGGCACTTCTTTGG 59.18
GAPDH-forward ACAGTCAGCCGCATCTTCTT 59.68 94 1.8
GAPDH-reverse ACGACCAAATCCGTTGACTC 58.21
U6-forward CCTCGCTTCGGCAGCACATA 62.91 94 1.3
U6-reverse ACGCTTCACGAATTTGCGT 59.06