Skip to main content

Table 1 The list of primer sequences

From: Possible involvement of normalized Pin1 expression level and AMPK activation in the molecular mechanisms underlying renal protective effects of SGLT2 inhibitors in mice

Gene Forward primer Reverse primer
mCTGF CAAAGCAGCTGCAAATACCA GGCCAAATGTGTCTTCCAGT
mCol1a1 GAGCGGAGAGTACTGGATCG GCTTCTTTTCCTTGGGGTTC
mCol1a2 CCGTGCTTCTCAGAACATCA GAGCAGCCATCGACTAGGAC
mIL-1b CGTGGACCTTCCAGGATGAG GCTCATATGGGTCCGACAGC
mIL-6 CCATCCAGTTGCCTTCTTGG TGCAAGTGCATCATCGTTGT
mMCP1 AGGTCCCTGTCATGCTTCTG TCTGGACCCATTCCTTCTTG
mTNFa GAACTGGCAGAAGAGGCACT AGGGTCTGGGCCATAGAACT
mTGFb1 TTGCTTCAGCTCCACAGAGA TGGTTGTAGAGGGCAAGGAC
mF4/80 TCTGGGGAGCTTACGATGGA TAGGAATCCCGCAATGATGG
mPin1 CGGCAGGAAAAGATCACCAG TCCCCTGTCCGTAGAGCAAA
mGAPDH TGATGGGTGTGAACCACG GGGCCATCCACAGTCTTCTG