Skip to main content

Advertisement

Table 1 List of primers used for RT-PCR using SYBR Green

From: An attempt to reverse cardiac lipotoxicity by aerobic interval training in a high-fat diet- and streptozotocin-induced type 2 diabetes rat model

Gene Length (bp) Forward sequence (5′ → 3′) Reverse sequence (3′ → 5′)
AMPK 153 CACTGGATGCACTCAACACAAC TCACTACCTTCCTTCAAAGTCC
FOXO1 299 CTTCAAGGATAAGGGCGACAG GCCATTTAGAAAACTGAGACCCA
CD36 167 AACCCAGAGGAAGTGGCAAG GACAGTGAAGGCTCAAAGATGG
PPARα 176 TCCACAAGTGCCTGTCCGTC CTTCAGGTAGGCTTCGTGGATT
β-tubulin 115 CGAGAAGAATACCCCGACCG CTACCAACTGGTGGACGGAC