Skip to main content

Table 1 Primers used for the analysis of adiponectin and resistin expression on mRNA level in adipose tissues

From: Adiponectin/resistin interplay in serum and in adipose tissue of obese and normal-weight individuals

Gene Gene description Gene bank Primers Annealing (oC)
ADIPOQ Adiponectin NM_001177800.1 F 5′GGTCTCGAACTCCTGGCCTA3′ 60
    R 5′TGAGATATCGACTGGGCATGGT3′  
RETN Resisitin NM_020415.3 F 5′GCTGTTGGTGTCTAGCAAGAC3′ 59
    R 5′CATCATCATCATCATCTCCAG3′  
ACTB β-Actin NM_001101 F 5′CAGCCTGGATAGCAACG-TACA3′ 61
    R 5′TTCTACAATGAGCTGCGTGTG3′