Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Sequence of primers

From: The promotion of nephropathy by Porphyromonas gingivalis lipopolysaccharide via toll-like receptors

Protein bp Upper (5′–3′) Lower (5′–3′)
β-Actin 411 GTTCTACAAATGTGGCTGAGGA ATTGGTCTCAAGTCAGTGTACAG
TLR2 210 TGTTTCTGAGTGTAGGGGCTTCA ACATGACAGAGACTCCTGAGCAG
STAT3 224 AACATTCTGGGCACGAACACAA AAGGAGTGGGTCTCTAGGTCAATC