β-Cell death is decreased in women with gestational diabetes mellitus

Table 1 Primer and probe sequences and PCR protocols for human insulin analysis

PCR type	Primer designation	Primer sequence 5′ → 3′	Amplicon length	PCR protocol
First-step PCR	Forward	TTAGGGGTTTTAAGGTAGGGTA	295 bp	50 cycles, annealing temperature 57 °C
First-step PCR	Reverse	ACCAAAAACAACAATAAACAATAACTC	295 bp	50 cycles, annealing temperature 57 °C
Methylation-specific nested qRTPCR	Common forward	GTGCGGTTTATATTTGGTGGAAGTT		50 cycles, annealing temperature: 52 °C Methylated
	Common reverse	ACAACAATAAACAATTAACTCACCCTACAA		50 cycles, annealing temperature: 52 °C Methylated
	Hypomethylated FAM probe	ACCTCCCAACAAATCT		65 °C Hypomethylated
	Methylated FAM probe	TACCTCTCGTCGAATCT		65 °C Hypomethylated

ISSN: 1758-5996