Skip to main content

Table 2 Information of single nucleotide polymorphism of ESR1 and its primer

From: A study for association and interaction analysis to metabolic syndrome and the ESR1 gene on cardiovascular autonomic neuropathy in a Chinese Han population

SNP Gene CH Allele MAFCEU MAFHCB MAFTPS HWE
rs9340799 ESR1 6 G/A 0.217 0.306 0.196 0.451
Up-stream CATCTGAGTTCCAAATGTCC
Down-stream GGATGAGCATTGGTCTCTAA
  1. SNP single nucleotide polymorphism, CH chromosome, MAF CEU minor allele frequency in Utah residents with Northern and Western European ancestry sample, MAF HCB minor allele frequency in Han Chinese in Beijing sample, MAF TPS minor allele frequency in the present sample, HWE p value from Hardy–Weinberg Equilibrium test in our sample