Skip to main content

Advertisement

Table 1 The oligonucleotide primers sequence of studied genes

From: The role of bone marrow derived-mesenchymal stem cells in attenuation of kidney function in rats with diabetic nephropathy

  Primer sequence
TNFα gene Forward primer: 5′- GACCCTCACACTCAG ATC ATC TTC T -3′
Reverse primer: 5′- TTGTCTTTGAGATCCATGCCA TT -3′
TGFβ gene Forward primer: 5′- AATGTCAGCTCAGGAACATCCA -3′
Reverse primer: 5′- GTTCCTGACACATGAACCCTTG -3′
Bcl2 gene Forward primer: 5′- GGAGGGCACTTCCTGAG -3′
Reverse primer: 5′- GCCTGGCATCACGACT -3′
Bax gene Forward primer: 5′- CTGAGCTGACCTTGGAGC -3′
Reverse primer: 5′- GACTCCAGCCACAAAGATG -3′
Beta actin Forward 5′-TGTTGTCCCTGTATGCCTCT-3′
Reverse 3′-TAATGTCACGCACGATTTCC-5′