Skip to main content

Table 1 Primers used in real-time fluorescence quantitative PCR

From: Effect of exenatide on the cardiac expression of adiponectin receptor 1 and NADPH oxidase subunits and heart function in streptozotocin-induced diabetic rats

Gene symbol primer (5′ → 3′) Product size (bp)
  Forward 5′- GATGCCGTCGGGTTTCCAGCA -3′ 233 bp
  Forward 5′-TCTAGGCCGTAACGGAATTC-3′ 245 bp
  Forward 5′-CTCTATTGTTGCAGGAGTGC-3′ 457 bp
  1. Glut4: glucose transporter type 4.